Instructor: Dr. Natalia Tretyakova, Ph.D. «hyperlink "mailto:Trety001@umn.edu"»    -   6-3432
 
PDB reference correction and design Dr.chem., Ph.D. Aris Kaksis, Associate Prof. mailto:ariska@latnet.lv
                                          DNA telomere repeat of chromosomes
 
Telomeric Repeat Binding Factor 1 + telomere=DNA 13 bp 1IV6.PDB
 
Helix loop turn Helix
 
TRF1 binds a bipartite telomeric site with extreme spatial flexibility
Alessandro Bianchi1, Rachel M. Stansel,Louise Fairall, Jack D. Griffith, Daniela RhodesandTitia de Lange1
1 The Rockefeller University, 1230 York Avenue, New York, NY 10021, 3 Lineberger Comprehensive Cancer Center, UNC, Chapel Hill, NC 27599-7295, USA and 4 MRC Laboratory Molecular Biology, Hills Road, Cambridge CB2 2QH, UK 2
Present address: Department of Molecular Biology, University of Geneva, 30 quai Ernest-Ansermet, CH-1211 Geneva 4, Switzerland 
 
TRF1 is a key player in telomere length regulation. Because length control was proposed to depend on the architecture of telomeres, we studied how TRF1 binds telomeric TTAGGG repeat DNA and alters its conformation. Although the single Myb-type helix-turn-helix motif of a TRF1 monomer can interact with telomeric DNA, TRF1 predominantly binds as a homodimer. Systematic Evolution of Ligands by Exponential enrichment (SELEX) with dimeric TRF1 revealed abipartite telomeric recognition site with extreme spatial variability. Optimal sites have two 2 copies of a 5'-YTAGGGTTR-3' half-site positioned without constraint on distance or orientation. Analysis of binding affinities and DNase I footprinting showed that both half-sites are simultaneously contacted by the TRF1 dimer, and electron microscopy revealed looping of the intervening DNA. We propose that a flexible segment in TRF1 allows the two 2 Myb domains of the homodimer to interact independently with variably positioned half-sites. This unusual DNA binding mode is directly relevant to the proposed architectural role of TRF1.
 
The telomeric sequences such as T2AG3, T2G4, TG4T, T2G4T, TG4T, TG3 T and T4G4 were seen to
form parallel-stranded G-quadruplexes with all the nucleotides having anti glycosidic torsion angles.
 

1EVM.PDB
 
Human telomeric DNA consists of a few 2000÷3000 kilobases of a short repetitive motif which is double-stranded, except for a 3'-terminal G-rich overhang (1–3) (Table 1). Telomere maintenance is necessary for long-term cell proliferation. In the absence of a specific replication machinery at the telomere ends it was predicted (4), and later demonstrated (5), that gradual sequence loss due to incomplete replication of the lagging strand would eventually lead to critically short telomeres and trimming of essential chromosomal sequences. The mechanism whereby cells count divisions uses the gradual erosion of telomeres, which ultimately triggers replicative senescence in many cell types. In order to compensate for this loss, different mechanisms for the addition of new telomere sequences have evolved. In humans, telomere maintenance is mainly performed by a specific reverse transcriptase, telomerase, which was initially identified in ciliates (6,7). Human telomerase is a ribonucleoprotein (8) composed of a catalytic subunit, hTERT (9–11), and a 451 nt long RNA (hTR; also known as hTER or hTERC) (12), which acts as a template for the addition of a short repetitive motif d(GGGTTA)n 5'-GGGTTA-3' on the 3'-end of a primer .
 

 
Figure 1. Telomerase components. Telomerase is composed of two 2 major components: the catalytic subunit and the template RNA (hTR). Several proteins are associated with hTERT or hTR and facilitate their folding or assembly. Many different proteins interact with telomeric DNA and participate in telomerase recruitment. Mutations in two telomerase component (hTR and dyskerin, in red) have been demonstrated to be involved into dyskeratosis congenita (DKC), a progressive bone-marrow failure syndrome
 

 
Figure 2. Strategies for telomerase inhibition. Possible pathways of pharmacological inhibition of telomerase: targeting of the catalytic subunit; antisense or ribozyme strategies against hTR; targeting telomeric DNA. See text for details.
Analysis of the DNA sequence surrounding the putative transcriptional start region reveals a
TATA-less, CAAT-less, GC-rich promoter located in a CpG island (65,76). Demethylation of DNA with 5-azacytidine in two cell lines induces expression of hTERT, suggesting that DNA methylation can contribute to hTERT repression in some cells. However, the TERT CpG island is unmethylated in some telomerase-negative primary tissues and non-immortalised cultured cells, indicating that mechanisms independent of DNA methylation can prevent hTERT expression.
 
                                          1  2
3Figure 3. Chemical formulae of some telomerase inhibitors. 1, TDG-TP {R=[P(=O)O2]34–}; 2, EGCG;
45
 
         3, BIBR 1532;                                         4, ß-rubromycins;                    5, isothiazolones (TMPI);
 
678
 
          6, rhodacyanines (FJ5002);                         7, bis-indoles;                                     8, telomestatin.
The properties of these molecules are detailed in Table 2.
 
Table 2. New telomerase inhibitors
 Familya  IC50b (µM) Targetc  Cell effectd 
 BIBR 1532 0.093 hTERT D
 ß-Rubromycin 3 ? ?
 Isothiazolones (TMPI) 1 hTERT? ?
 Rhodacyanines (FJ5002) 2 hTERT? ?
 Bis-indoles 2 ? ?
 Catechins (EGCG) 1 ? ?
 Telomestatin 0.005 ? ?
 TDG-TP 0.06 Nucleoside ?
 Ribozymes ? hTR I
 PNA <0.001 hTR D
 2'-OMe (oligonucleotide) hTR D (238,239)
 2'-MOE (oligonucleotide) 0.005 hTR D
 2'-5'A-oligonucleotide ? hTR I/D
 N3'P5' phosphoramidates <0.001 hTR ?
 Dibenzophenanthrolines 0.03 G4 ?
 Acridines 0.06 G4 ?
 RHPS4 (pentacyclic acridine) 0.3 G4 D
 Ethidium 0.03 G4 ?
 Triazines 0.04 G4 D
 Bis-acridine 0.75 G4 ?
aOnly the most active compound of each family is presented. Chemical formulae of some of these agents are shown in Figures 3 and 4. 2'-OME and 2'-MOE are oligoribonucleotides with a modified sugar in the 2' position (see Fig. 4).
bIC50 of the most active compound belonging to that family.
cMechanism of action/target: G4, quadruplex ligands; hTR, the RNA component of telomerase is targeted; hTERT, the catalytic subunit is targeted; Nucleoside, nucleoside analog.
dCellular effect: ?, not determined; I, immediate inhibition of cell growth or viability; D, delayed inhibition.
 

 
                                          DNA centromere repeat of chromosomes
CenpB box DNA centromer helix-turn-helix protein binding
 

 
The human centromere protein B (CENP-B) (Gene Map Locus: 20p13), one of the centromere components, specifically binds a 17 bp sequence (the CENP-B box),
--->B chain 5' GCC T T CG T T GG  A  A ACGGG  A T T 3'
<---C chain 3' CGG A  A GC  AA   CC T T T GCCC T A A 5'
which appears in every other a-satellite repeat. In the present study, the crystal structure of the complex of the DNA-binding region (129 AA residues) of CENP-B and the CENP-B box DNA has been determined at 2.5 Å resolution. The DNA-binding region forms two helix÷turn÷helix domains, which are bound to adjacent major grooves of the DNA. The DNA is kinked at the two recognition helix contact sites, and the DNA region between the kinks is straight. Among the major groove protein-bound DNAs, this ‘kink÷straight÷kink’ bend contrasts with ordinary ‘round bends’ (gradual bending between two protein contact sites). The larger kink (43°) is induced by a novel mechanism, ‘phosphate bridging by an arginine-rich helix’: the recognition helix with an arginine cluster is inserted perpendicularly into the major groove and bridges the groove through direct interactions with the phosphate groups. The overall bending angle is 59°, which may be important for the centromere-specific chromatin structure.
 
Crystal structure of parallel quadruplexes from human telomeric DNA .
 
1KF1.PDB
 
Telomeric ends AGGGTTAGGGTTAGGGTTAGGG 22 bases of chromosomes, which comprise noncoding repeat sequences of guanine-rich DNA, are fundamental in protecting the cell from recombination and degradation. Disruption of telomere maintenance leads to eventual cell death, which can be exploited for therapeutic intervention in cancer. Telomeric DNA sequences can form four-stranded (quadruplex) structures, which may be involved in the structure of telomere ends. Here we describe the crystal structure of a quadruplex formed from four consecutive human telomeric DNA repeats and grown at a K(+) concentration that approximates its intracellular concentration. 3 K(+) ions are observed in the structure. The folding and appearance of the DNA in this intramolecular quadruplex is fundamentally different from the published Na(+)-containing quadruplex structures. All four DNA strands are parallel, with the three linking trinucleotide loops positioned on the exterior of the quadruplex core, in a propeller-like arrangement. The adenine in each TTA linking trinucleotide loop is swung back so that it intercalates between the two Thymines. This DNA structure suggests a straight forward path for telomere folding and unfolding, as well as ways in which it can recognize telomere-associated proteins.
 
Human Tbp Complex With TATA Element DNA   
 
1TGH.PDB 
--->5'-Cg T A T A T A T A Cg-3'
<---3'-gC A T A T A T A T gC-5'
 
1TUP.PDB tumor Suppressor P53 Zn finger three domains + DNA
 

--->5'- T T T CC T A  g A C T T gCCC A  A T T A -3'
<---3'- A  A A gg  A T C T g  A A Cggg T T A A T -5'
 
1TRO.PDB Trp Repressor With Operator on 19 bp DNA two segments
 

 
---> J chain 5'-TgTACTAgTTAACTAgTAC|TgTACTAgTTAACTAgTA C    -3' chain L --->
<--- I chain 3'-    CATgATCAATTgATCATgT|CATgATCAATTgATCATgT -5' chain K <---
 
T7 RNA Polymerase Pyrimidine Promoter on DNA 14 bp fragment
 

 
---> D chain 5'- T CggC   A A T T gCCg  A -3'  chain  D --->
<--- E chain  3'- A  gCCg T T  A A  CggC T -5' chain  E <---