Biochemistry of Medicinals I Phar 6151 CHAPTER Seven
Instructor: Dr. Natalia Tretyakova, Ph.D.
PDB reference correction and design Dr.chem., Ph.D. Aris Kaksis, Associate Professor
 
Regulation of Gene Expression
 
I.       Regulation of gene expression in prokaryotes.
 
•The rate of protein synthesis in E. Coli varies 1000-fold in response to environmental changes
(temprerature, nutrients, etc.)
      Gene activity is primarily regulated on the level of transcripttion
      Prokaryotes regulate the expression of their genes in order to save the energy:  instead of continuously making unnecessary proteins, they are synthesiszed only when they are needed.
 
Two main types of prokaryotic genes:
 
1.   Constitutively expressed genes (house-keeping genes) – always on
2.   Regulated genes (inducible or repressible) –turned on and off
 
b-galactosidase of E. Coli is an example of inducible enzyme
 
E. coli  can use lactose as carbon source by hydrolyzing lactose to galactose and glucose
                                                                                                                               catalyzed by b-galactosidase:

       b-D-Galactose unit         || a-D-Glucose unit              b-D-Galactose unit        || a-D-Glucose unit  a-lactose (from the milk of mammals)
         Haworth projections  ||                                                           Chair structures ||                         for connection Gal(b1-->4)Glc-a
                                         b-Galactosidase -->|| + H2O                                               + H2O ||<-- b-Galactosidase
 +    + 
 
When E. Coli is grown on glucose, it contains little b-galactosidase. In the presence of lactose, several E. Coli enzymes are induced, including b-galactosidase, galactoside permease, and thio-galactoside trans-acetylase. Constitutive mutants synthesize large amounts of all three 3 proteins independent of the presence of lactose.
 
Lac operon + Lactose : ◊ + ∆ =  ◊∆ ---> induce the Transcription
 
b-galactosidase, galactoside permease, and thio-galactoside trans-acetylase are encoded by three
                                                                                                3 contiguous genes z, y, and a, respectively:
          T H E   L A C - O P E R O N
          R             P   O        z                  y                   a          STOP
• • •|••••|• • •|•••|•••|••••••••••|••••••••••••|••••••••••••|•••••••|• • • DNA anti-sence strand
          ||                        ||◊||∆     ||                       ||                          ||
mRNA I gene || ◊­||∆­ ||--> ——  ———  ———                   mRNA
 ◊ repressor ||-->∆­ ||--> b-Gal'ase       ||          b-Gal-trans-Ac
                    LACTOSE        ||       lac-permease          ||
                               Splits LAC    Pumps LAC  Not involved in
                               into Gal+Glc   into the cell   LAC metabolism
 
The expression of all three 3 genes is under control of a common element that contains control genes (P and O) and a regulator gene (R).
 
Functions of various regions of the Lac operon ◊ :
 
P Promoter Binding site for RNA Pol
O Operator DNA control region that prevents transcription when repressor is bound
I Regulator gene Codes for the repressor protein ◊
z, y, and a Structural genes Code for b-galactosidase, galactoside permease, and
                                                 thio-galactoside trans-acetylase, respectively
 
The binding of repressor protein to operator prevents transcription of  z, y, and a. In the presence of lactose, allolactose is formed which serves as inducer. Another inducer is isopropylthiogalactoside (ITPG). Binding of inducer to repressor protein prevents the latter from interaction with the operator. This leads to transcription of z, y, and a and eventually the synthesis of the corresponding proteins.
 
   ——— ¾® — 
       i mRNA --->­ repressor + inducer     --->        repressor-IPTG  deactivated
 
Lac inducers:       
 
                                  1,6 Allolactose                                                             IPTG
 
Interactions between lac repressor protein and operator sequence
 
·     Lac repressor protein is a tetramer of identical 37 kD subunits
·     It tightly binds operator sequence (Kd = 10-13 M )
·     Finds operator site by diffusing along --->--->---> DNA molecule
·     High selectivity for operator sequence (106)
 
Lac operator sequence has the same two-fold symmetry as the repressor protein.
            The operator region directly interacting with the lac repressor is shown below:
 
5’…GAATTGTGACGCGGATAACAATTT…3’
3’…CTTAACACTGCGCCTATTGTTAAA…5’
 
Note the symmetrically related regions (highlighted)
 
Catabolite repression
 
·     The level of b-galactosidase is low || in the presence of glucose, the preferred E. Coli carbon source
·     Glucose suppresses lac operon transcription by lowering the concentration of cyclic AMP (cAMP)
·     The function of cAMP in bacteria is to activate CAP (catabolite gene activation protein)
·     cAMP-CAP complex binds promoter sites, stimulating the transcription of lac operon  by bending DNA and attracting RNA Polymerase to the promoter site
 
 cAMP-  cyclic Adenosine Mono-Phosphate
 
Conclusions
 
1.   Lac is an inducible catabolic operon that is placed under dual control.
2.   High ­ levels of expression require the presence of both lactose and cAMP
3.   cAMP levels are lowered ¯ in the presence of glucose, enabling E.Coli to conserve time and energy needed for synthesis of lac proteins when they are not required