Aris Kaksis Riga University docent - Chemistry

Protein Synthesis in eukaryotes
Instructor: Dr. Natalia Tretyakova, Ph.D. «hyperlink "mailto:Trety001@umn.edu"» - 6151
PDB reference correction and design Dr.chem., Ph.D. Aris Kaksis, Associate Prof. e-mail: :ariska@latnet.lv

Required reading: Stryer 4th Ed. Ch. 34 p. 903-906

Eukaryotic Ribosome

80S

Eukaryotes	Prokaryotes
60S subunit	50 S
40S subunit	30S
28S RNA 5S RNA 5.8S RNA 18S RNA	23S RNA 5S RNA - 16S RNA

Table 1. The genetic code. for mRNA Y Genetic Code

1st position	2nd position				3rd position
(5' end)-->	U	C	A	G	(3' end)-->
U	Phe Phe Leu Leu	Ser Ser Ser Ser	Tyr Tyr STOP STOP	Cys Cys STOP SelenoCys Trp Mitochondria Trp	U C A G
C	Leu Leu Leu Leu	Pro Pro Pro Pro	His His Gln Gln	Arg Arg Arg Arg	U C A G
A	Ile Ile Ile Met init	Thr Thr Thr Thr	Asn Asn Lys Lys	Ser Ser Arg Arg	U C A G
G	Val Val Val Val	Ala Ala Ala Ala	Asp Asp Glu Glu	Gly Gly Gly Gly	U C A G

Sets of three 3 nucleotides (codons) in an mRNA molecule are translated into amino acids AA in the course of protein synthesis according to the rules shown. The codons G U G and GAG, for example, are translated into valine and glutamic acid, respectively. Note that those codons with U or C as the second 2 nucleotide tend to specify the more hydrophobic amino acids AA.

Initiation of Translation: Ribosomal Binding Site

                                             Shine-Delgarno
16S                                    U CC U CCA
mRNA 5’ GA U U CC U A GG A GGU U U GACC U A U G GCC U U U 3’
Protein                                                                                         fMet   Ala       Phe

Initiation of Translation in eukaryotes

• Initiating AA tRNA is Met, not fMet;
• Initiator tRNA is Met-tRNA;
• Initiatior signal is AUG – no Shine-Delgarno sequence;
• 40S subunit-Met-tRNA; - initiation factors complex binds 5’ cap and scans mRNA for the nearest AUG

Eukaryotic mRNA is 5’-Capped

Eukaryotic counterparts of bacterial factors

Initiation                             Bacteria Eukaryotes
                                            IF 1, 3      eIF4, eIF3, eIF4-9
                                            IF 2          eIF2
                                            -                cap-binding factors
Elongation
                                            EF-Tu      eEF1a
                                            EF-Ts       eEF1bg
                                            EF-G        eEF2
Termination
                                            RF-1         eRF
                                            RF-2
                                            RF-3
Diphtheria toxin

• a protein that catalyzes modification of eEF2, inhibiting eukaryotic protein synthesis
• Adds ADP ribose, blocking eEF2 ability to carry out translocation

Protein Synthesis in eukaryotes

1) Eukaryotic translation has many similarities to prokaryotic protein synthesis.
2) Notable differences include different ribosome size/composition, soluble protein factors,
                                                                                           and the mechanism of initiation.
3) Eukaryotic genes typically code for one 1 protein, while
                                                                    many prokaryotic genes are polycistronic.
4) Eukaryotic transcription and translation are separated in space and time.
5) Most antibiotics are selective for bacterial protein synthesis.

          Posttranslational processing of proteins
1.       Protein folding
2.       Proteolytic cleavage
3.       Amino acid modification
4.       Attachment of carbohydrates
5.       Addition of prosthetic groups

Control of gene expression: Take Home Message

1) Gene expression in all organisms is mainly controlled at the level of
                                                                                transcription initiation.

2) Two 2 types of gene expression exist: constitutive and inducible/repressible genes.

3) Control of transcription rates is achieved by binding of the regulatory proteins to
                                       promoter region, which turns RNA polymerase ‘on’ or ‘off’.

4) Regulatory proteins contain common structural motifs that enable them
                            to recognize specific regions of DNA via noncovalent interactions.

Flow of genetic information

DNA ||-----------------> RNA -----------------> Proteins ----------->>> Cellular action
Replication ||     || transcription                  translation              ----------->>>>>>>||||||||| 
           ||                    nucleare
    DNA nucleare <= Reverse transcription of telomeres

                                    Notable exception: retroviruses
RNA ||-----> DNA -----> RNA -------------> Proteins ---------->>>>>>> Cellular action
Reverse ||transcription  transcription          translation                        ---------->>>|||| 
    DNA cytosolic      nucleare

Regulation of gene expression in bacteria

· rate of protein synthesis in E. Coli can vary 1000-fold

· Gene activity is regulated on the level of transcription

Two 2 main types of prokaryotic genes:

1.    1. Constitutively expressed genes (housekeeping genes) – always on
R    2. Regulated genes – turned on in response to environmental conditions

beta-galactosidase of E. Coli is an example of inducible enzyme

Lactose
beta-galactosidase || + H2O

The Lac-Operon   O

     I(r) permeasep    O     z          Y           A          stop
==|=======|= = =|=====|=====|=========|===========|============|=========|= = DNA
     *******       ||    ----->||-----> **********    ***********    ************                             mRNA
      ∆∆∆∆∆∆       ||            ||----->∆∆∆∆∆∆∆∆       ∆∆∆∆∆∆∆∆∆     ∆∆∆∆∆∆∆∆∆∆                          protein
    repressor        ||           ||            b-gal'ase        lac-permease    S-gal-trans-Ac                        protein
                LAC Lactose      || Splits LAC into      Pumps LAC into   Not involved in
      removed operon O<---||       Gal + Glc         the cell                     LAC metabolism

P	Promoter	Binding site for RNA Pol
O	Operator	DNA control region that prevents transcription when repressor is bound
I ( R )	Regulator repressor gene	Codes for the repressor protein
Z , Y , A	Structural genes	Code for b-galactosidase, galactoside permease, and thiogalactoside transacetylase, respectively

Control of transcription in lac operon

——

||-->I mRNA ----->

||Operon--->+

Inducer <--- IPTG

——

1,6-allolactose --->=>

-----> IPTG
Inducer

Prokaryotic mRNAs often are polycistronic
(encode more than one polypeptide)

(a) transcription in the presence of an inducer

RNA polymerase binds, transcription of structural genees begins
Inactivated repressor cannot bind to operator
Inducer molecules bind to repressor, inactivating it Beta-Galactosidase Permease Acetyl transferase

Interactions between lac repressor protein and operator sequence

• Lac repressor protein is a tetramer of identical 37 kd subunits
• It tightly binds operator sequence (Kd = 10-13 M)
• Finds operator site by diffusing along DNA molecule
• High selectivity for operator sequence (106)
5’ …GAATTGTGACGGATAACAATTT…3’
3’… CTTAACACT GCCTATTGTTAAA…5’

LAC repressor 1LCC.PDB

Lac repressor bends DNA

Zinc Finger

"INDEPENDENCE OF METAL BINDING BETWEEN TANDEM CYS2HIS2 ZINC FINGER DOMAINS"
B.A. Krizek, L.E. Zawadzke, and J.M. Berg

Contents of file KRIZEK.KIN: 1ZAA.PDB
Kin.1 - Calpha trace of the Zif/268-DNA complex structure

1D66.PDB-Zn2+-Gal4
Leucine zipper 2ZTA.PDB

        Turn the sidechains back on, and notice that the interhelical contacts are made by sets of residues that look like wide rungs on a ladder (not, in fact, like teeth on a zipper). Every other rung contains a pair of orange leucines; alternate rungs contain pairs of gold valines, with one Met pair at the top and one Asn pair near the middle. In this kinemage, all of the Leu zipper sidechains are grouped and color-coded by their position in the seven-residue heptad repeat: 'd' (Leu) in orange; 'a' (Val) in gold, or in hotpink for Asn 16; 'e' and 'g', the contact-edge hydrophilics, in skyblue; and the outside positions 'b', 'c', and 'f' in cyan. Turn on the "heptad lbl" button to see labels a through g for one repeat.
        An end view of the Leu zipper supercoil shows the helix-helix contacts most clearly. Choose Reset2 under Graphics, "zoom, etc" under the Other menu, and zoom to enlarge the image. Turn off the "e, g" and the "b, c, f" buttons, to concentrate on the buried contact layers at positions a and d. For a detailed tour, set the zoom to 3.0, the zslab to 100, and move the slider to the top of the ztrans scrollbar; you should see just a little backbone and the sidechains of Met 2 at the end of each helix. Then hold down the mouse just above the arrow at the bottom of the ztrans scrollbar to move the structure fairly rapidly through the visible slab. A little more than one "rung", or layer, will be in view at a time. Notice how similar the geometry is for each rung of Leu 'd' sidechains; Val 'a' rungs are also similar to one another, but different in detail from Leu rungs. Leu Cbetas point toward each other and their Cgammas turn out; Val Cbetas point outward, while one of their Cgammas points inward to touch. Val is too short for optimal contact in a 'd' position, and Leu would not work in an 'a' position, because although its Cgamma could lie in the correct place its Cdeltas would then bump into the opposite helix.
        Turn on the "e, g" side chains and move the structure through the slab again by holding down the mouse just below the up arrow on the ztrans scrollbar. Notice how a given leucine contacts four surrounding sidechains on the opposite helix: its symmetry-mate Leu in 'd', the two adjacent 'a' residues, and the preceding 'g' residue. This kind of arrangement is called "knobs-into-holes" packing. It is usually not found in such a regular form in globular proteins, but was originally proposed by Francis Crick in 1953 to stabilize coiled coils.

Catabolite repression

• The level of b-galactosidase is low in the presence of glucose
• Glucose suppresses lac operon transcription by lowering the
concentration of cyclic AMP (cAMP)
• The function of cAMP in bacteria is to activate CAP (Catabolite gene Activator Protein)
• cAMP-CAP complex binds promoter sites, stimulating the transcription of lac operon

cAMP Promoter sequences for different genes

Promoter for:          -35 region   Spacer         -10 region      Spacer    || Transcribed
trp operon     G     TTGACA     N17       TTAACT        N7        A
tRNATyr         G    TTTACA      N16       TATGAT        N7        A
lP2                 G    TTGACA     N17       GATACT        N6        G
lac operon      C    TTTACA     N17       TATGTT        N6        A
rec A               C    TTGATA      N16       TATAAT        N7        A
lex A                G   TTCCAA      N17       TATACT        N6        A
T7A3               G   TTGACA      N17       TACGAT        N7        A
Consensus         TTGACA                  TATAAT

Enhancers can stimulate transcription from many nucleotides away

                                        Enhancers
Looping of DNA

                           -200                          -100                                                    +1
                             |                                 |                                                          |
                                                <--------------                                                                                                                           ----------->
                             Late RNA                                                                        Early RNA
SV40 ——————————————

———————————

||<--------GC box ||---->
|| || RNA
DHFR —————

————

—————

——————

—————

||<--------GC box ||----->
|| || RNA
Heat-shock gene —

———

—————

——

———
                                                                                                      TATA
                                                    ||<----------------Heat-shock element

1. Steroid hormone response elements (HRE) Estrogen, progesterone, glucocortecoids
2. P53 tumor suppressor gene.

Control of gene expression: Take Home Message

1) Gene expression in all organisms is mainly controlled at the level of
                                                                                                       transcription initiation.

2) Two 2 types of gene expression exist: constitutive and inducible / repressible genes.

3) Control of transcription rates is achieved by binding of the regulatory proteins to
                                             promoter region, which turns RNA polymerase ‘on’ or ‘off’.

4) Regulatory proteins contain common structural motifs that enable them to recognize
                                                          specific regions of DNA via noncovalent interactions.