Previous section Next section
THE GENETIC CODE
Body_ID: HC032002
The code of life is degenerate, not quite universal, and unpunctuated
Body_ID: HC032005
page 447
0
page 448
Body_ID: P0448
Body_ID: T032001
Table 32-1. Amino acids specified by each of the codons.
Body_ID: None
The genetic code
Body_ID: T032001.50
CodonAmino acidCodonAmino acidCodonAmino acidCodonAmino acid
Body_ID: T032001.100
AAAlysine (Lys)CAAglutamine (Gln)GAAglutamic acid (Glu)UAAStop
Body_ID: T032001.150
AAG CAG GAG UAG 
Body_ID: T032001.200
AACasparagine (Asn)CAChistidine (His)GACaspartic acid (Asp)UACtyrosine (Tyr)
Body_ID: T032001.250
AAU CAU GAU UAU 
Body_ID: T032001.300
ACAthreonine (Thr)CCAproline (Pro)GCAalanine (Ala)UCAserine (Ser)
Body_ID: T032001.350
ACC CCC GCC UCC 
Body_ID: T032001.400
ACG CCG GCG UCG 
Body_ID: T032001.450
ACU CCU GCU UCU 
Body_ID: T032001.500
AGAarginine (Arg)CGAarginine (Arg)GGAglycineView drug information (Gly)UGA 
Body_ID: T032001.550
AGG CGC GGC   
Body_ID: T032001.600
  CGG GGG UGGStop
Body_ID: T032001.650
AGCserine (Ser)CGU GGU  tryptophan (Trp)
Body_ID: T032001.700
AGU     UGCcysteine (Cys)
Body_ID: T032001.750
  CUAleucine (Leu)GUAvaline (Val)UGU 
Body_ID: T032001.800
AUGmethionineView drug information (Met)CUC GUC   
Body_ID: T032001.850
  CUG GUG UUAleucine (Leu)
Body_ID: T032001.900
AUAisoleucine (Ile)CUU GUU UUG 
Body_ID: T032001.950
AUC       
Body_ID: T032001.1000
AUU     UUCphenylalanine (Phe)
Body_ID: T032001.1050
      UUU 
Body_ID: T032001.1100
Body_ID: T032001.1150
Body_ID: T032001

Note that the first and second positions of codons that specify the same amino acid are generally the same.
Body_ID: None
MUTATION OF THE GENETIC CODE
Body_ID: B032001
Sickle cell anemia
Body_ID: PB32001
Sickle cell anemia is an example of a disease in which a single nucleotide change within the coding region of the gene for the β-chain of hemoglobin A, the major form of adult hemoglobin, yields an altered protein that has impaired function. The mutation that causes this disease is a single nucleotide change in a codon that normally specifies glutamate (GAG), and which produces a codon that specifies valine (GUG). Under conditions of low oxygen tension, this single amino acid change causes the protein to polymerize into rod-shaped structures, resulting in deformation and altered rheological properties of red blood cells. This substitution of an acidic for a nonpolar, hydrophobic amino acid is known as a non-conservative mutation. Conservative mutations of one amino acid by another with similar physical and chemical properties usually have less severe consequences.
Body_ID: PB32002
When one considers the transfer of information from RNA containing only four different bases (adenine, A; cytosine, C; guanine, G; and uracil, U) to a protein containing 20 different amino acidsView drug information, it is apparent that there is not a one-to-one correspondence between nucleotide and amino acid sequence. In fact, three nucleotides in the mRNA, known as a codon, are required to specify each amino acid. There is thus a total of 64 possible codons when all combinations of four nucleotides are taken into account three at a time (Table 32.1). Three of these codons (UAA, UAG, UGA) are used as signals to stop the synthesis of a protein, and do not specify an amino acid. This leaves 61 codons to specify 20 amino acidsView drug information, and illustrates a feature of the genetic code known as degeneracy, i.e. more than one codon can specify a specific amino acid. For example, codons GGU, GGC, GGA, and GGG all code for the amino acid, glycineView drug information. Indeed, all the amino acidsView drug information, with the exception of methionineView drug information and tryptophan, have more than one codon. The codon AUG, which specifies only methionineView drug information, has a dual role: it encodes methionineView drug information anywhere it occurs in the RNA, and it also marks the start of protein synthesis.
Body_ID: P032004
The genetic code as specified by the triplet nucleotides is, for the most part, the same for bacteria and humans, and is referred to as 'universal'. However, there are notable exceptions. In bacteria, if the codons GUG and UUG occur at the beginning of protein synthesis, they can be read as a methionineView drug information codon. In addition, the protein synthesis stop-codon, UAA, can encode a tryptophan amino acid in some lower eukaryotic organisms such as Paramecium and Tetrahymena. There are also minor differences in the genetic code in mitochondria.
Body_ID: P032005
Another aspect of the genetic code is that it is translated without punctuation. This means that, once synthesis has started at an AUG codon for methionineView drug information, each successive triplet from that start point will be read without interruption until a termination codon is encountered. Thus the 'reading frame' of the mRNA will be dictated by the AUG codon. This means that mutations that cause the addition or deletion of single nucleotides will cause a frame shift, resulting in a protein with a different (nonsense) amino acid sequence after the mutation, or a protein that is prematurely terminated (Table 32.2).
Body_ID: P032006
page 448
0
page 449
Body_ID: P0449
Body_ID: T032002
Table 32-2. Effect of mutations on the primary sequence of the encoded protein.
Body_ID: None
Effect of mutations on protein synthesis
Body_ID: T032002.50
NormalAUGGCAUUACAGGUAUUACUACGAGGCACACCUGAA . . .functional
Body_ID: T032002.100
geneMetAlaLeuGlnValLeuLeuArgGlyThrProGluprotein
Body_ID: T032002.150
insertionAUGGCAUUUACAGGUAUUACUACGAGGCACACCUGA A . . .premature
Body_ID: T032002.200
 MetAlaPheArgGlyIleThrThrArgHisThrStoptermination
Body_ID: T032002.250
   ↓          
Body_ID: T032002.300
deletionAUGGCAUACAGGUAUUACUACGAGGCACACCUGAAA . . .different
Body_ID: T032002.350
 MetAlaTyrArgTyrTyrTyrGluAlaHisLeuLysprotein
Body_ID: T032002.400
altered baseAUGGCAUUACAGGAAUUACUACGAGGCACACCUGAA . . .single amino
Body_ID: T032002.450
 MetAlaLeuGlnGluLeuLeuArgGlyThrProGluacid change
Body_ID: T032002.500
altered baseAUGGCAUUACAGGUAUUACUGCGAGGCACACCUGAA . . .no change
Body_ID: T032002.550
 MetAlaLeuGlnValLeuLeuArgGlyThrProGlu 
Body_ID: T032002.600
Body_ID: T032002.650
Body_ID: T032002

Note that the location of the mutation will dictate the extent of change observed in the primary sequence. Insertion and deletion mutations cause frame shifts that lead to synthesis of nonsense proteins with either premature or delayed termination.
Body_ID: None
Previous section
Bar end Bar end
Next section
Copyright © 2007 Elsevier Inc. All rights reserved. Read our Terms and Conditions of Use and our Privacy Policy.
For problems or suggestions concerning this service, please contact: studentconsult.help@elsevier.com